Chapter 19 The Organization and Control of Eukaryotic Genomes

Outline

• Eukaryotic Chromatin Structure

• Control of Gene Expression

• The Molecular Biology of Cancer

• Noncoding DNA in the genome

The Genome

• Individual DNA/protein strands are called Chromosomes

• The DNA strands are bound to proteins and collectively termed Chromatin

– 40% DNA and 60% protein

Chromatin Structure

• Eukaryotic DNA comes as linear chromosomes.

• DNA is packaged around proteins called histones.

– Histones are positively charged

• The DNA and histones are bundled into nucleosomes.

• The string of nucleosomes coils to form a 30 nm chromatin fiber.

• The 30 nm fiber is looped and attached to a non-histone protein scaffold forming 300 nm looped domains.

• The looped domains are further folded to form a 700nm fiber which makes up the arm of a chromatid. (

Heterochromatin and Euchromatin

• Heterochromatin is more tightly compacted, and visible even during interphase.

– Not transcribed.

• Euchromatin is less compacted.

– Transcribed DNA is found in euchromatin.

– Believed to be more accessible.

Cellular Differentiation

The structural and functional divergence of cells as they become specialized during a multicellular organisms�f development.

Cellular Differentiation

• Four of the many different types of human cells

What proteins would be expressed in high levels in each of the cell types?

• Skeletal muscle fiber:

• Neuron:

• Sperm Cells:

• Red Blood Cells:

Control of Gene Expression

• Genes that are turned on all the time are “constitutively expressed”.

– Housekeeping genes.

– Examples:

• Other genes are expressed in response to requirements of the cell or organism.

– “turned on” “induced” “up regulated”

The Effect of Chromosome Structure on Gene Regulation

• In addition to it’s structural role, the organization of chromatin can influence gene expression.

– Unused genes packed into heterochromatin

– Nucleosomes can block promoters.

– DNA methylation can cause long term inactivation of genes.

– Acetylation (-COCH₃) of histones.

• Acetyl groups cause histone to grip the DNA less tightly, giving greater access of transcription factors to genes in the acetylated region.

An Overview of Transcriptional Control

• The key mechanism of regulation of gene expression is by controlling initiation of transcription.

• In prokaryotes, genes are turned on an off in response to the cells immediate environment.

– Most changes are fully reversible.

• In eukaryotes gene are modulated in response to the demand of homeostasis or development.

– Transcription initiation is controlled by proteins that interact with DNA and with each other.

• Fine tuning

• Can be irreversible

Organization of a Typical Eukaryotic Gene (Fig. 19.5)

• The promoter is just upstream of the start of transcription.

– The transcription initiation complex assembles on the promoter.

Organization of a Typical Eukaryotic Gene (Fig. 19.5)

• Control elements are segments of noncoding DNA that help regulate transcription.

– Enhancers are control elements that are located far away from the promoter.

– Other control elements are close to the promoter.

Transcription Factors

• A set of proteins helps RNA polymerase bind to the promoter regions.

– This results in a low level initiation of transcription.

• Modular regulatory proteins bind to distant sites called enhancers.

– This results in further regulation of transcription, and is usually necessary for very high levels of transcription.

• Activators increase transcription, repressors decrease transcription.

Enhancers

• Enhancer proteins are modular

• Contain a DNA binding domain, and a regulatory domain.

• The DNA loops around so that the enhancer is positioned near the promoter.

• Adds flexibility, a great number of regulatory proteins can influence a single promoter.

Figure 19.6

Postranscriptional Control in Eukaryotes

• Alternative Splicing

– Different mRNA molecules can be produced from the same primary transcript.

– Only 20,000 – 25,000 genes in humans, but many of these are thought to be alternatively spliced.

Figure 19.5 A eukaryotic gene and its transcript

Figure 19.8 Alternative RNA splicing

Posttranscriptional Control, cont.

• Selectively degrading mRNA transcripts

– Eukaryotic mRNAs can vary in stability .

• 1 hour v. 10 hour half life.

– Specific sequences on the 3’ end can target them for degradation.

– microRNAs (miRNAs) can bind to complimentary sequences, blocking translation and targeting for degradation.

Posttranscriptional Control, cont.

• Selecting which mRNAs are translated

– Translational repressor proteins bind the 5’ end of cytosolic mRNAs.

• Many mRNAs are made ahead by the mother, and stored in the egg, but are not translated until fertilization.

• Ferritin mRNAs are bound by aconitase. When iron binds aconitase, it dissociates from ferritin mRNA, which is translated.

Posttranscriptional Control, cont.

• Protein Processing

– Phosphorylation

• Ex. Kinases in signal pathways

– cleavage to an active form

• Ex. Insulin, trypsin,

Posttranscriptional Control, cont.

• Protein Degradation

– Proteins that are no longer needed are target for destruction.

• Ex. Cyclin degradation in cell cycle control.

Cancer is a Genetic Disease

• Cancer results from genetic changes that influence the cell cycle.

• Mutations in two key sets of genes can lead to cancer.

– Proto-oncogenes

– Tumor suppressor genes

• Most mutations are somatic.

• However, certain genes can cause cancer in families.

Oncogenes

• Oncogenes are cancer causing genes that are mutated versions of normal cellular genes, called proto-oncogenes.

• Proto-oncogenes code for protein that stimulate normal cell growth and division.

How do proto-oncogenes become oncogenes? (Fig. 19.11)

Tumor Suppressor Genes

• Tumor suppressor genes encode proteins that normally help prevent uncontrolled cell growth.

– Cell cycle control genes

– DNA repair genes

– Adhesion of cells to the extracellular matrix.

Fig. 19.12a Cell Cycle-stimulating pathway: If a mutation makes Ras or any other pathway component abnormally active, excessive cell division and cancer may result.

Fig. 19.12b. Cell Cycle Inhibiting Pathway. Mutations causing deficiencies in any pathway component can contribute to the development of cancer.

Ras and p53

• Ras is a proto-oncogene that is mutated (to make an oncogene) in about 30% of human cancers.

– Cell cycle stimulating pathway

• p53 is a tumor suppressor gene that is mutated to make a faulty protein in about 50% of human cancers.

– Cell cycle inhibiting pathway

The Multistep Model for Cancer (Fig. 19.13)

• Cancer results as a progression of mutations in tumor-suppressor and proto-oncogenes.

• Usually about four different genes are mutated in a cancer cell.

Genetics of Cancer

• Proto-oncogenes encode proteins that stimulate cell division.

– Mutated proto-oncogenes become activated cancer-causing version of these genes, called oncogenes.

– Oncogenes are genetically dominant

Genetics of Cancer

• Tumor-Suppressor Genes Inhibit Cell Proliferation

– Mutation in Tumor-Suppressor Genes inactivate the cell’s inhibitors of proliferation.

– Mutations in Tumor-Suppressor Genes are genetically recessive.

Causes of Cancer

• Viruses play a roles in about 15% of human cancers.

– Retroviruses increase the likelihood of leukemia.

– Hepatitis viruses increase the likelihood of liver cancer.

• Viruses may bring an oncogene into the genome or disrupt a tumor suppressor gene.

Causes of Cancer

• Inherited mutations are implicated in certain cancer.

• 15% of colorectal cancers.

– DNA repair genes; APC tumor suppressor gene.

• 5-10% of breast cancer

– BRCA1, BRCA2 tumor suppressor genes

Causes of Cancer

• Carcinogens

– Chemicals and substances that can mutate DNA.

– Can convert proto-oncogenes into oncogenes and alter tumor suppressor genes so that they are non-functional or produce a faulty protein.

Causes of Cancer

• Common carcinogens

– Tobacco smoke – causes 80-90% of lung cancers.

– Ionizing radiation – Ultra violet light; xrays, etc.

– Chemicals - Asbestos, nickel, cadmium, uranium, radon, vinyl chloride, benzidene, and benzene

Causes of Cancer

• Age

– The longer you live, the more time there is for mutations in proto-oncogenes and tumor suppressor genes to accumulate.

– Also, telomere shorten with increase number of cell divisions, which causes mutations in genes at the ends of chromosomes.

Eukaryotic Genomes

• In prokaryotic cells, virtually of the DNA codes for protein or RNA, or contains regulatory sequences. There is no ‘extra DNA’.

• In cells of multicellular eukaryotes, only 1.5% of the genome contains genes.

• The remainder of the DNA is called “junk” DNA .

– This includes introns and stretches of DNA between coding sequences.

– Much of the DNA in between genes is repetitive.

Tranposons

• “A mobile segment of DNA that serves as an agent of DNA change”

Figure 19.x2 Transposons in corn

Figure 19.16 Retrotransposon movement

Repetitive DNA

• Consists of

– Tandemly Repetitive DNA

• Ex. GTTACGTTACGTTACGTTACGTTAC

– Interspersed Repetitive DNA – each unit is hundreds to thousands of base pairs long.

• May play a structural or organizational role.

Fig.19.19 Evolution of the human globin gene families.

Genome Evolution

• Duplications, rearrangements and mutations contribute.

• Multigene families arise from ancestral gene.

• Exon Shuffling results in new genes.

The End.